caption a7 standard curve Search Results


99
ATCC caption a7 s aureus strain mic
Caption A7 S Aureus Strain Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/caption+a7+standard+curve/pmc01855559-241-23-39?v=ATCC
Average 99 stars, based on 1 article reviews
caption a7 s aureus strain mic - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

96
ATCC caption a7 survival curve
Caption A7 Survival Curve, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/caption+a7+standard+curve/pmc01618569-180-51-65?v=ATCC
Average 96 stars, based on 1 article reviews
caption a7 survival curve - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Monobind caption a7 standard curve
Caption A7 Standard Curve, supplied by Monobind, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/caption+a7+standard+curve/pmc04554595-80-39-55?v=Monobind
Average 96 stars, based on 1 article reviews
caption a7 standard curve - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

95
ATCC caption a7 standard rifampin resistant
Caption A7 Standard Rifampin Resistant, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/caption+a7+standard+curve/pmc00104802-150-50-58?v=ATCC
Average 95 stars, based on 1 article reviews
caption a7 standard rifampin resistant - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

90
National Institute of Standards and Technology liquid chromatography-mass spectrometry
Common pitfalls in quantitative and qualitative interpretation of data from botanical extracts
Liquid Chromatography Mass Spectrometry, supplied by National Institute of Standards and Technology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/caption+a7+standard+curve/pmc06658353-298-16-43?v=National+Institute+of+Standards+and+Technology
Average 90 stars, based on 1 article reviews
liquid chromatography-mass spectrometry - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

99
ATCC t5 caption a7 strain plasmid description reference e coli strains
Bacterial strains and plasmids in this study
T5 Caption A7 Strain Plasmid Description Reference E Coli Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/caption+a7+standard+curve/pmc02814767-53-23-41?v=ATCC
Average 99 stars, based on 1 article reviews
t5 caption a7 strain plasmid description reference e coli strains - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp vegfa hs00900055 m1
Gene and Specific TagMan Assay Identification
Gene Exp Vegfa Hs00900055 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/caption+a7+standard+curve/pmc06983748-185-40--1?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
gene exp vegfa hs00900055 m1 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

95
ATCC caption a7 time kill curves for mssa
In vitro activities of TD-6424 and comparator antibiotics against MRSA and <t> MSSA </t>
Caption A7 Time Kill Curves For Mssa, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/caption+a7+standard+curve/pmc00253794-67-64-70?v=ATCC
Average 95 stars, based on 1 article reviews
caption a7 time kill curves for mssa - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

90
BIOCYTEX Inc quantification standard cellquant
In vitro activities of TD-6424 and comparator antibiotics against MRSA and <t> MSSA </t>
Quantification Standard Cellquant, supplied by BIOCYTEX Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/caption+a7+standard+curve/pmc01808801-114-56-75?v=BIOCYTEX+Inc
Average 90 stars, based on 1 article reviews
quantification standard cellquant - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

97
Gilead Sciences caption a7 plasma concentration time curve
In vitro activities of TD-6424 and comparator antibiotics against MRSA and <t> MSSA </t>
Caption A7 Plasma Concentration Time Curve, supplied by Gilead Sciences, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/caption+a7+standard+curve/pmc00105839-259-55-69?v=Gilead+Sciences
Average 97 stars, based on 1 article reviews
caption a7 plasma concentration time curve - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

90
NSABP Foundation consort diagram for nsabp r-04
In vitro activities of TD-6424 and comparator antibiotics against MRSA and <t> MSSA </t>
Consort Diagram For Nsabp R 04, supplied by NSABP Foundation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/caption+a7+standard+curve/pmc04050205-207-36-41?v=NSABP+Foundation
Average 90 stars, based on 1 article reviews
consort diagram for nsabp r-04 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp vsx2 mm00432549 m1
End point analyses of mouse and human differentiations. (a) Flow cytometry analysis of <t>CHX10</t> at D6 of mouse differentiation represented in a scatter plot and histogram. (b) Flow cytometry analysis of CHX10 at D17 of human differentiation represented in a scatter plot and histogram. (c) Immunocytochemistry for CHX10 (green) and Hoechst (blue) on plated mouse aggregates at D6. Scale bar = 100 μm, (d) Immunocytochemistry for CHX10 (green) and Hoeschst (blue) on human monolayer cultures at D17. Scale bar = 100 μm, (e) qPCR on D6 mouse cultures. Reported fold change is compared to cultures that did not receive DAPT, n = 3 from distinct samples. (f) qPCR on D17 human cultures. Reported fold change is compared to PSCs. Error bars indicate standard deviation, n = 3 from distinct samples.
Gene Exp Vsx2 Mm00432549 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/caption+a7+standard+curve/pmc07243683-1310-32--1?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
gene exp vsx2 mm00432549 m1 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

Image Search Results


Common pitfalls in quantitative and qualitative interpretation of data from botanical extracts

Journal: Natural product reports

Article Title: Selection and Characterization of Botanical Natural Products for Research Studies: A NaPDI Center Recommended Approach

doi: 10.1039/c8np00065d

Figure Lengend Snippet: Common pitfalls in quantitative and qualitative interpretation of data from botanical extracts

Article Snippet: 67 fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window Figure 2. caption a7 Representative liquid chromatography-mass spectrometry (LC-MS) fingerprinting of a green tea sample (A) compared against an authentic green tea ( Camellia sinensis ) standard from the National Institute of Standards and Technology (NIST 3254) (B).

Techniques: Concentration Assay, Aerosol, Mass Spectrometry, Spectrophotometry, Positive Control, Quantitation Assay, Extraction, Comparison, Biomarker Discovery, Solvent, Software

Bacterial strains and plasmids in this study

Journal:

Article Title: Characterization of BNT2 , an intrinsically curved DNA of Escherichia coli O157:H7

doi: 10.1016/j.bbrc.2009.12.160

Figure Lengend Snippet: Bacterial strains and plasmids in this study

Article Snippet: If necessary, the antibiotics were used at the following concentrations: ampicillin (Ap), 100 μg/ml and kanamycin (Km), 50 μg/ml. table ft1 table-wrap mode="anchored" t5 caption a7 Strain / plasmid Description Reference E. coli strains: DH5a A general cloning host RBC a ATCC 43894 E. coli O157:H7 (a human clinical isolate, stx 1 + / stx 2 + ) ATCC b YH2021 ATCC 43894 with a single copy BNT2∷lacZ This study Plasmids: pSKBNT2 1,041-bp BNT2 fragments in pBluescript SK+ [ 22 ] pRBC/BNT2 BNT2 fragments in RBC TA cloning vector This study pRBC/AT24M AT24M in RBC TA cloning vector This study pRBC/BNT2-134 a 134-bp region of BNT2 in RBC TA cloning vector This study pRBC/AT24M-134 a 134-bp region of AT24M in RBC TA cloning vector This study pRS551 a lacZYA' operon fusion vector (pBR322 origin, Ap R Km R ) [ 31 ] pRSBNT2 BNT2 in pRS551 (Ap R Km R ) [ 22 ] pSP417 A lacZYA' operon fusion vector (pBR322 origin, Ap R ) [ 34 ] pSPBNT2 BNT2 in pSP417 (Ap R ) [ 22 ] pSPAT24M AT24M in pSP417 (Ap R ) This study Open in a separate window a Real Biotech Corporation, Taiwan b American Type Culture Collection, Manassas, VA caption a8 Bacterial strains and plasmids in this study The DNA nucleotide sequence of BNT2 was obtained from the GenBank database ( http://www.ncbi.nlm.nih.gov/sites/entrez?db=nucleotide ) available at National Center for Biotechnology Information (NCBI) with the accession number AY330225 .

Techniques: Plasmid Preparation, Cloning, TA Cloning

Involvement of a local intrinsic curvature within the unusual promoter sequence of BNT2 in its temperature-dependent transcription. (A) The HindIII-restricted fragments containing the 134-bp BNT2 or AT24M promoter regions were subjected to 2-D PAGE as indicated with 1.0 ug of the 100-bp ladder DNA marker (Gibco BRL). The 2-D gels were visualized with UV light after EtBr staining. The arrow indicates the DNA fragments containing the 134-bp BNT2 or AT24M promoter regions. The dash lines showed the migration status of the 200-bp DNA marker band on the 2-D gels and used to compare to the migration status of the DNA fragments containing the 134-bp BNT2 or AT24M promoter regions. (B) Temperature-dependent transcriptional activity of BNT2 and AT24M. The multi-copy transcriptional fusion plasmids of BNT2 (pSPBNT2) or AT24M (pSPAT24M) were constructed on a promoterless operon fusion vector (pSP471) and transformed into E. coli DH5α. The lacZ expression was measured as β-galactosidase activity after grown in LB at 37 or 24°C. The enzyme activities are represented as the means ± standard deviation from at least three independent experiments.

Journal:

Article Title: Characterization of BNT2 , an intrinsically curved DNA of Escherichia coli O157:H7

doi: 10.1016/j.bbrc.2009.12.160

Figure Lengend Snippet: Involvement of a local intrinsic curvature within the unusual promoter sequence of BNT2 in its temperature-dependent transcription. (A) The HindIII-restricted fragments containing the 134-bp BNT2 or AT24M promoter regions were subjected to 2-D PAGE as indicated with 1.0 ug of the 100-bp ladder DNA marker (Gibco BRL). The 2-D gels were visualized with UV light after EtBr staining. The arrow indicates the DNA fragments containing the 134-bp BNT2 or AT24M promoter regions. The dash lines showed the migration status of the 200-bp DNA marker band on the 2-D gels and used to compare to the migration status of the DNA fragments containing the 134-bp BNT2 or AT24M promoter regions. (B) Temperature-dependent transcriptional activity of BNT2 and AT24M. The multi-copy transcriptional fusion plasmids of BNT2 (pSPBNT2) or AT24M (pSPAT24M) were constructed on a promoterless operon fusion vector (pSP471) and transformed into E. coli DH5α. The lacZ expression was measured as β-galactosidase activity after grown in LB at 37 or 24°C. The enzyme activities are represented as the means ± standard deviation from at least three independent experiments.

Article Snippet: If necessary, the antibiotics were used at the following concentrations: ampicillin (Ap), 100 μg/ml and kanamycin (Km), 50 μg/ml. table ft1 table-wrap mode="anchored" t5 caption a7 Strain / plasmid Description Reference E. coli strains: DH5a A general cloning host RBC a ATCC 43894 E. coli O157:H7 (a human clinical isolate, stx 1 + / stx 2 + ) ATCC b YH2021 ATCC 43894 with a single copy BNT2∷lacZ This study Plasmids: pSKBNT2 1,041-bp BNT2 fragments in pBluescript SK+ [ 22 ] pRBC/BNT2 BNT2 fragments in RBC TA cloning vector This study pRBC/AT24M AT24M in RBC TA cloning vector This study pRBC/BNT2-134 a 134-bp region of BNT2 in RBC TA cloning vector This study pRBC/AT24M-134 a 134-bp region of AT24M in RBC TA cloning vector This study pRS551 a lacZYA' operon fusion vector (pBR322 origin, Ap R Km R ) [ 31 ] pRSBNT2 BNT2 in pRS551 (Ap R Km R ) [ 22 ] pSP417 A lacZYA' operon fusion vector (pBR322 origin, Ap R ) [ 34 ] pSPBNT2 BNT2 in pSP417 (Ap R ) [ 22 ] pSPAT24M AT24M in pSP417 (Ap R ) This study Open in a separate window a Real Biotech Corporation, Taiwan b American Type Culture Collection, Manassas, VA caption a8 Bacterial strains and plasmids in this study The DNA nucleotide sequence of BNT2 was obtained from the GenBank database ( http://www.ncbi.nlm.nih.gov/sites/entrez?db=nucleotide ) available at National Center for Biotechnology Information (NCBI) with the accession number AY330225 .

Techniques: Sequencing, Marker, Staining, Migration, Activity Assay, Construct, Plasmid Preparation, Transformation Assay, Expressing, Standard Deviation

Gene and Specific TagMan Assay Identification

Journal: Tissue Engineering. Part A

Article Title: Amorphous Silicon Oxynitrophosphide-Coated Implants Boost Angiogenic Activity of Endothelial Cells

doi: 10.1089/ten.tea.2019.0051

Figure Lengend Snippet: Gene and Specific TagMan Assay Identification

Article Snippet: The housekeeping gene was 18S , and the studied genes were: VEGF-A , HIF-1α , Ang-1 , nesprin-2 , SOD-1 , Cat-1 , and NOS-3 ( ). table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Gene Assay identification VEGF-A Hs00900055_m1 HIF-1α Hs00153153_m1 Ang-1 Hs00919202_m1 Nesprin-2 ( SYNE2 ) Hs00794881_m1 SOD-1 Hs00533490_m1 Cat-1 ( CAT ) Hs00156308_m1 e-NOS ( NOS3 ) Hs01574665_m1 Open in a separate window CAT-1 , catalase-1; HIF-1α , hypoxia-inducible factor-1α; SOD-1 , superoxide dismutase 1; VEGF-A , vascular endothelial growth factor A. Gene and Specific TagMan Assay Identification Statistics The data are shown as the mean ± standard deviation.

Techniques:

In vitro activities of TD-6424 and comparator antibiotics against MRSA and  MSSA

Journal:

Article Title: In Vitro Activity of TD-6424 against Staphylococcus aureus

doi: 10.1128/AAC.47.11.3602-3604.2003

Figure Lengend Snippet: In vitro activities of TD-6424 and comparator antibiotics against MRSA and MSSA

Article Snippet: Linezolid at 8 μg/ml reduced the initial inoculum from log 10 5.76 ± 0.07 CFU/ml to log 10 2.73 ± 0.08 CFU/ml by 4 h, and vancomycin at 32 μg/ml decreased it from log 10 5.76 ± 0.07 CFU/ml to log 10 4.82 ± 0.02 CFU/ml over this period. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window FIG. 1. caption a7 Time-kill curves for MSSA (ATCC 13709) (A), MRSA (ATCC 33591) (B), and GISA (HIP 5836) (C). (A) Vancomycin at 4 times the MIC (⧫), nafcillin at 4 times the MIC (▪), linezolid at 4 times the MIC (▴), and TD-6424 at 4 times the MIC (▵); (B) vancomycin at 8 times the MIC (⧫), linezolid at 8 times the MIC (▴), and TD-6424 at 8 (▵) and 32 (▪) times the MIC; (C) linezolid at 4 times the MIC (▴), vancomycin at 4 times the MIC (⧫), and TD-6424 at 4 (▵), 8 (▪), and 16 (□) times the MIC.

Techniques: In Vitro

Time-kill curves for MSSA (ATCC 13709) (A), MRSA (ATCC 33591) (B), and GISA (HIP 5836) (C). (A) Vancomycin at 4 times the MIC (⧫), nafcillin at 4 times the MIC (▪), linezolid at 4 times the MIC (▴), and TD-6424 at 4 times the MIC (▵); (B) vancomycin at 8 times the MIC (⧫), linezolid at 8 times the MIC (▴), and TD-6424 at 8 (▵) and 32 (▪) times the MIC; (C) linezolid at 4 times the MIC (▴), vancomycin at 4 times the MIC (⧫), and TD-6424 at 4 (▵), 8 (▪), and 16 (□) times the MIC. ✻, bacterial growth control. The nafcillin MIC was 1 μg/ml for ATCC 13709. Vancomycin MICs were 1, 1, and 8 μg/ml for ATCC 13709, ATCC 33591, and HIP 5836, respectively; the corresponding values were 2, 2, and 2 μg/ml for linezolid and 1, 1, and 2 μg/ml for TD-6424.

Journal:

Article Title: In Vitro Activity of TD-6424 against Staphylococcus aureus

doi: 10.1128/AAC.47.11.3602-3604.2003

Figure Lengend Snippet: Time-kill curves for MSSA (ATCC 13709) (A), MRSA (ATCC 33591) (B), and GISA (HIP 5836) (C). (A) Vancomycin at 4 times the MIC (⧫), nafcillin at 4 times the MIC (▪), linezolid at 4 times the MIC (▴), and TD-6424 at 4 times the MIC (▵); (B) vancomycin at 8 times the MIC (⧫), linezolid at 8 times the MIC (▴), and TD-6424 at 8 (▵) and 32 (▪) times the MIC; (C) linezolid at 4 times the MIC (▴), vancomycin at 4 times the MIC (⧫), and TD-6424 at 4 (▵), 8 (▪), and 16 (□) times the MIC. ✻, bacterial growth control. The nafcillin MIC was 1 μg/ml for ATCC 13709. Vancomycin MICs were 1, 1, and 8 μg/ml for ATCC 13709, ATCC 33591, and HIP 5836, respectively; the corresponding values were 2, 2, and 2 μg/ml for linezolid and 1, 1, and 2 μg/ml for TD-6424.

Article Snippet: Linezolid at 8 μg/ml reduced the initial inoculum from log 10 5.76 ± 0.07 CFU/ml to log 10 2.73 ± 0.08 CFU/ml by 4 h, and vancomycin at 32 μg/ml decreased it from log 10 5.76 ± 0.07 CFU/ml to log 10 4.82 ± 0.02 CFU/ml over this period. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window FIG. 1. caption a7 Time-kill curves for MSSA (ATCC 13709) (A), MRSA (ATCC 33591) (B), and GISA (HIP 5836) (C). (A) Vancomycin at 4 times the MIC (⧫), nafcillin at 4 times the MIC (▪), linezolid at 4 times the MIC (▴), and TD-6424 at 4 times the MIC (▵); (B) vancomycin at 8 times the MIC (⧫), linezolid at 8 times the MIC (▴), and TD-6424 at 8 (▵) and 32 (▪) times the MIC; (C) linezolid at 4 times the MIC (▴), vancomycin at 4 times the MIC (⧫), and TD-6424 at 4 (▵), 8 (▪), and 16 (□) times the MIC.

Techniques: Control

PAE for TD-6424 and comparator antibiotics

Journal:

Article Title: In Vitro Activity of TD-6424 against Staphylococcus aureus

doi: 10.1128/AAC.47.11.3602-3604.2003

Figure Lengend Snippet: PAE for TD-6424 and comparator antibiotics

Article Snippet: Linezolid at 8 μg/ml reduced the initial inoculum from log 10 5.76 ± 0.07 CFU/ml to log 10 2.73 ± 0.08 CFU/ml by 4 h, and vancomycin at 32 μg/ml decreased it from log 10 5.76 ± 0.07 CFU/ml to log 10 4.82 ± 0.02 CFU/ml over this period. fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window FIG. 1. caption a7 Time-kill curves for MSSA (ATCC 13709) (A), MRSA (ATCC 33591) (B), and GISA (HIP 5836) (C). (A) Vancomycin at 4 times the MIC (⧫), nafcillin at 4 times the MIC (▪), linezolid at 4 times the MIC (▴), and TD-6424 at 4 times the MIC (▵); (B) vancomycin at 8 times the MIC (⧫), linezolid at 8 times the MIC (▴), and TD-6424 at 8 (▵) and 32 (▪) times the MIC; (C) linezolid at 4 times the MIC (▴), vancomycin at 4 times the MIC (⧫), and TD-6424 at 4 (▵), 8 (▪), and 16 (□) times the MIC.

Techniques:

End point analyses of mouse and human differentiations. (a) Flow cytometry analysis of CHX10 at D6 of mouse differentiation represented in a scatter plot and histogram. (b) Flow cytometry analysis of CHX10 at D17 of human differentiation represented in a scatter plot and histogram. (c) Immunocytochemistry for CHX10 (green) and Hoechst (blue) on plated mouse aggregates at D6. Scale bar = 100 μm, (d) Immunocytochemistry for CHX10 (green) and Hoeschst (blue) on human monolayer cultures at D17. Scale bar = 100 μm, (e) qPCR on D6 mouse cultures. Reported fold change is compared to cultures that did not receive DAPT, n = 3 from distinct samples. (f) qPCR on D17 human cultures. Reported fold change is compared to PSCs. Error bars indicate standard deviation, n = 3 from distinct samples.

Journal: Nature protocols

Article Title: V2a Interneuron Differentiation from Mouse and Human Pluripotent Stem Cells

doi: 10.1038/s41596-019-0203-1

Figure Lengend Snippet: End point analyses of mouse and human differentiations. (a) Flow cytometry analysis of CHX10 at D6 of mouse differentiation represented in a scatter plot and histogram. (b) Flow cytometry analysis of CHX10 at D17 of human differentiation represented in a scatter plot and histogram. (c) Immunocytochemistry for CHX10 (green) and Hoechst (blue) on plated mouse aggregates at D6. Scale bar = 100 μm, (d) Immunocytochemistry for CHX10 (green) and Hoeschst (blue) on human monolayer cultures at D17. Scale bar = 100 μm, (e) qPCR on D6 mouse cultures. Reported fold change is compared to cultures that did not receive DAPT, n = 3 from distinct samples. (f) qPCR on D17 human cultures. Reported fold change is compared to PSCs. Error bars indicate standard deviation, n = 3 from distinct samples.

Article Snippet: A list of primers used to characterize the V2a interneuron population can be found in . table ft1 table-wrap mode="anchored" t5 Table 2| caption a7 Primer Mouse (Assay ID) Human (Sequence) CHX10 Mm00432549_m1 F: CGGCGACACAGGACAATCTT R: CCTGTATCCTGTCTTCCGGC CRX N/A F: CCTTCTGACAGCTCGGTGTT R: TGGTGTACTTCAGCGGTCAC FOXN4 Mm00521694_m1 F: CGTACAGCTGTCTGATCGCC R: GGAGCCGCTCATCTTGTTCT HB9 Mm01222622_m1 F: TCTCTTAACGGGAAGGGGCA R: CTAATTCAGGGCGCTCTCGG LHX3 Mm01330619_g1 N/A N/A SOX14 N/A F: GAACCCTTGCACTCCCTACC R: TCGATGTATGGCCGCTTCTC Open in a separate window Primers used in qPCR for mouse and human analyses. list-behavior=simple prefix-word= mark-type=none max-label-size=2 D. Calcium analysis of mouse cells – TIMING: variable list-behavior=enumerated prefix-word= mark-type=lower-roman max-label-size=0 For calcium imaging, seed co-cultured aggregates onto laminin-coated wells in DFK5NB medium supplemented with B27, 100x GlutaMAX , 5 ng/mL of NT-3, GDNF, BDNF, PDGF, and 0.5 μL/mL of reconstituted AAV1-hSyn-GCaMP6f vector.

Techniques: Flow Cytometry, Immunocytochemistry, Standard Deviation

Cryopreservation of human V2a interneuron cultures. (a) Flow cytometry analysis of CHX10 at D17 and after three days of recovery following cryopreservation. (b) Total viable cell count at D17 and after three days of recovery following cryopreservation. Error bars indicate standard deviation from mean, n = 3 for D17 and n = 2 for thawed from distinct samples. Immunocytochemistry of CHX10 (green) and Hoechst (blue) at D17 (c) and three days of recovery following cryopreservation (d). Scale bar = 50 μm.

Journal: Nature protocols

Article Title: V2a Interneuron Differentiation from Mouse and Human Pluripotent Stem Cells

doi: 10.1038/s41596-019-0203-1

Figure Lengend Snippet: Cryopreservation of human V2a interneuron cultures. (a) Flow cytometry analysis of CHX10 at D17 and after three days of recovery following cryopreservation. (b) Total viable cell count at D17 and after three days of recovery following cryopreservation. Error bars indicate standard deviation from mean, n = 3 for D17 and n = 2 for thawed from distinct samples. Immunocytochemistry of CHX10 (green) and Hoechst (blue) at D17 (c) and three days of recovery following cryopreservation (d). Scale bar = 50 μm.

Article Snippet: A list of primers used to characterize the V2a interneuron population can be found in . table ft1 table-wrap mode="anchored" t5 Table 2| caption a7 Primer Mouse (Assay ID) Human (Sequence) CHX10 Mm00432549_m1 F: CGGCGACACAGGACAATCTT R: CCTGTATCCTGTCTTCCGGC CRX N/A F: CCTTCTGACAGCTCGGTGTT R: TGGTGTACTTCAGCGGTCAC FOXN4 Mm00521694_m1 F: CGTACAGCTGTCTGATCGCC R: GGAGCCGCTCATCTTGTTCT HB9 Mm01222622_m1 F: TCTCTTAACGGGAAGGGGCA R: CTAATTCAGGGCGCTCTCGG LHX3 Mm01330619_g1 N/A N/A SOX14 N/A F: GAACCCTTGCACTCCCTACC R: TCGATGTATGGCCGCTTCTC Open in a separate window Primers used in qPCR for mouse and human analyses. list-behavior=simple prefix-word= mark-type=none max-label-size=2 D. Calcium analysis of mouse cells – TIMING: variable list-behavior=enumerated prefix-word= mark-type=lower-roman max-label-size=0 For calcium imaging, seed co-cultured aggregates onto laminin-coated wells in DFK5NB medium supplemented with B27, 100x GlutaMAX , 5 ng/mL of NT-3, GDNF, BDNF, PDGF, and 0.5 μL/mL of reconstituted AAV1-hSyn-GCaMP6f vector.

Techniques: Flow Cytometry, Cell Counting, Standard Deviation, Immunocytochemistry

Flow cytometry gating strategy. (a) Gating of Hoechst+ cells in the secondary only control and the CHX10 stained mouse cells. (b) Gating of CHX10+ cells in the secondary only control and the CHX10 stained mouse cells. (c) Gating of cell population using forward scattered area (FSC-A) vs. side scattered area (SSC-A) in the IgG control and the CHX10 stained human cells. (d) Gating of single cells using FSC-A vs. forward scattered height (FSC-H) in the IgG control and the CHX10 stained human cells. (e) Gating of the CHX10+ cells in the IgG control and the CHX10 stained human cells.

Journal: Nature protocols

Article Title: V2a Interneuron Differentiation from Mouse and Human Pluripotent Stem Cells

doi: 10.1038/s41596-019-0203-1

Figure Lengend Snippet: Flow cytometry gating strategy. (a) Gating of Hoechst+ cells in the secondary only control and the CHX10 stained mouse cells. (b) Gating of CHX10+ cells in the secondary only control and the CHX10 stained mouse cells. (c) Gating of cell population using forward scattered area (FSC-A) vs. side scattered area (SSC-A) in the IgG control and the CHX10 stained human cells. (d) Gating of single cells using FSC-A vs. forward scattered height (FSC-H) in the IgG control and the CHX10 stained human cells. (e) Gating of the CHX10+ cells in the IgG control and the CHX10 stained human cells.

Article Snippet: A list of primers used to characterize the V2a interneuron population can be found in . table ft1 table-wrap mode="anchored" t5 Table 2| caption a7 Primer Mouse (Assay ID) Human (Sequence) CHX10 Mm00432549_m1 F: CGGCGACACAGGACAATCTT R: CCTGTATCCTGTCTTCCGGC CRX N/A F: CCTTCTGACAGCTCGGTGTT R: TGGTGTACTTCAGCGGTCAC FOXN4 Mm00521694_m1 F: CGTACAGCTGTCTGATCGCC R: GGAGCCGCTCATCTTGTTCT HB9 Mm01222622_m1 F: TCTCTTAACGGGAAGGGGCA R: CTAATTCAGGGCGCTCTCGG LHX3 Mm01330619_g1 N/A N/A SOX14 N/A F: GAACCCTTGCACTCCCTACC R: TCGATGTATGGCCGCTTCTC Open in a separate window Primers used in qPCR for mouse and human analyses. list-behavior=simple prefix-word= mark-type=none max-label-size=2 D. Calcium analysis of mouse cells – TIMING: variable list-behavior=enumerated prefix-word= mark-type=lower-roman max-label-size=0 For calcium imaging, seed co-cultured aggregates onto laminin-coated wells in DFK5NB medium supplemented with B27, 100x GlutaMAX , 5 ng/mL of NT-3, GDNF, BDNF, PDGF, and 0.5 μL/mL of reconstituted AAV1-hSyn-GCaMP6f vector.

Techniques: Flow Cytometry, Control, Staining

Enrichment of V2a interneuron populations. (a) Flow cytometry analysis of CHX10 in D6 unselected and selected mouse cultures. Data from Iyer et al.9 Flow cytometry analysis of CHX10 in D20 cultures that have or have not been replated using WTB hiPSCs (b) or WTC hiPSCs (c). P-value determined by unpaired two-tailed t test. Error bars indicate standard deviation from mean, n = 3 from distinct samples.

Journal: Nature protocols

Article Title: V2a Interneuron Differentiation from Mouse and Human Pluripotent Stem Cells

doi: 10.1038/s41596-019-0203-1

Figure Lengend Snippet: Enrichment of V2a interneuron populations. (a) Flow cytometry analysis of CHX10 in D6 unselected and selected mouse cultures. Data from Iyer et al.9 Flow cytometry analysis of CHX10 in D20 cultures that have or have not been replated using WTB hiPSCs (b) or WTC hiPSCs (c). P-value determined by unpaired two-tailed t test. Error bars indicate standard deviation from mean, n = 3 from distinct samples.

Article Snippet: A list of primers used to characterize the V2a interneuron population can be found in . table ft1 table-wrap mode="anchored" t5 Table 2| caption a7 Primer Mouse (Assay ID) Human (Sequence) CHX10 Mm00432549_m1 F: CGGCGACACAGGACAATCTT R: CCTGTATCCTGTCTTCCGGC CRX N/A F: CCTTCTGACAGCTCGGTGTT R: TGGTGTACTTCAGCGGTCAC FOXN4 Mm00521694_m1 F: CGTACAGCTGTCTGATCGCC R: GGAGCCGCTCATCTTGTTCT HB9 Mm01222622_m1 F: TCTCTTAACGGGAAGGGGCA R: CTAATTCAGGGCGCTCTCGG LHX3 Mm01330619_g1 N/A N/A SOX14 N/A F: GAACCCTTGCACTCCCTACC R: TCGATGTATGGCCGCTTCTC Open in a separate window Primers used in qPCR for mouse and human analyses. list-behavior=simple prefix-word= mark-type=none max-label-size=2 D. Calcium analysis of mouse cells – TIMING: variable list-behavior=enumerated prefix-word= mark-type=lower-roman max-label-size=0 For calcium imaging, seed co-cultured aggregates onto laminin-coated wells in DFK5NB medium supplemented with B27, 100x GlutaMAX , 5 ng/mL of NT-3, GDNF, BDNF, PDGF, and 0.5 μL/mL of reconstituted AAV1-hSyn-GCaMP6f vector.

Techniques: Flow Cytometry, Two Tailed Test, Standard Deviation

Maturation of V2a interneuron cultures. (ai) Immunocytochemistry of selected mouse V2a interneurons at D18 stained for vesicular glutamate transporter 2 (VGlut2, green) and Hoechst (blue). (aii) Immunocytochemistry of selected mouse V2a interneurons co-cultured with Olig2+ cells at D34 stained for VGlut2 (green), Hoechst (blue), and imaged for TdTomato (red) to identify V2a interneurons. (bi) Immunocytochemistry of V2a interneurons at D20 stained for CHX10 (green), VGlut2 (red), and Hoechst (blue). (bii) Immunocytochemistry of V2a interneurons at D60 stained for CHX10 (green), VGlut2 (red), and Hoechst (blue). (c) Fluorescent imaging of hSyn-GCaMP6f in mouse V2a-Olig2 aggregates at D22. Arrowheads demarcate areas of calcium flux. (d) The differentiation was performed with the WTC hiPSC cell line harboring the genetically-encoded calcium sensor GCaMP6f. Fluorescent imaging of constitutive GCaMP6f in human V2a interneuron cultures at D45. Arrowheads demarcate areas of calcium flux. All scale bars = 50 μm.

Journal: Nature protocols

Article Title: V2a Interneuron Differentiation from Mouse and Human Pluripotent Stem Cells

doi: 10.1038/s41596-019-0203-1

Figure Lengend Snippet: Maturation of V2a interneuron cultures. (ai) Immunocytochemistry of selected mouse V2a interneurons at D18 stained for vesicular glutamate transporter 2 (VGlut2, green) and Hoechst (blue). (aii) Immunocytochemistry of selected mouse V2a interneurons co-cultured with Olig2+ cells at D34 stained for VGlut2 (green), Hoechst (blue), and imaged for TdTomato (red) to identify V2a interneurons. (bi) Immunocytochemistry of V2a interneurons at D20 stained for CHX10 (green), VGlut2 (red), and Hoechst (blue). (bii) Immunocytochemistry of V2a interneurons at D60 stained for CHX10 (green), VGlut2 (red), and Hoechst (blue). (c) Fluorescent imaging of hSyn-GCaMP6f in mouse V2a-Olig2 aggregates at D22. Arrowheads demarcate areas of calcium flux. (d) The differentiation was performed with the WTC hiPSC cell line harboring the genetically-encoded calcium sensor GCaMP6f. Fluorescent imaging of constitutive GCaMP6f in human V2a interneuron cultures at D45. Arrowheads demarcate areas of calcium flux. All scale bars = 50 μm.

Article Snippet: A list of primers used to characterize the V2a interneuron population can be found in . table ft1 table-wrap mode="anchored" t5 Table 2| caption a7 Primer Mouse (Assay ID) Human (Sequence) CHX10 Mm00432549_m1 F: CGGCGACACAGGACAATCTT R: CCTGTATCCTGTCTTCCGGC CRX N/A F: CCTTCTGACAGCTCGGTGTT R: TGGTGTACTTCAGCGGTCAC FOXN4 Mm00521694_m1 F: CGTACAGCTGTCTGATCGCC R: GGAGCCGCTCATCTTGTTCT HB9 Mm01222622_m1 F: TCTCTTAACGGGAAGGGGCA R: CTAATTCAGGGCGCTCTCGG LHX3 Mm01330619_g1 N/A N/A SOX14 N/A F: GAACCCTTGCACTCCCTACC R: TCGATGTATGGCCGCTTCTC Open in a separate window Primers used in qPCR for mouse and human analyses. list-behavior=simple prefix-word= mark-type=none max-label-size=2 D. Calcium analysis of mouse cells – TIMING: variable list-behavior=enumerated prefix-word= mark-type=lower-roman max-label-size=0 For calcium imaging, seed co-cultured aggregates onto laminin-coated wells in DFK5NB medium supplemented with B27, 100x GlutaMAX , 5 ng/mL of NT-3, GDNF, BDNF, PDGF, and 0.5 μL/mL of reconstituted AAV1-hSyn-GCaMP6f vector.

Techniques: Immunocytochemistry, Staining, Cell Culture, Imaging

Seeding density is critical to human V2a interneuron differentiation. Flow cytometry analysis of CHX10 at D17 using varying initial seeding densities with WTB iPSCs (a) and WTC GCaMP iPSCs (b). Error bars indicate standard deviation from mean, n = 3 from distinct samples.

Journal: Nature protocols

Article Title: V2a Interneuron Differentiation from Mouse and Human Pluripotent Stem Cells

doi: 10.1038/s41596-019-0203-1

Figure Lengend Snippet: Seeding density is critical to human V2a interneuron differentiation. Flow cytometry analysis of CHX10 at D17 using varying initial seeding densities with WTB iPSCs (a) and WTC GCaMP iPSCs (b). Error bars indicate standard deviation from mean, n = 3 from distinct samples.

Article Snippet: A list of primers used to characterize the V2a interneuron population can be found in . table ft1 table-wrap mode="anchored" t5 Table 2| caption a7 Primer Mouse (Assay ID) Human (Sequence) CHX10 Mm00432549_m1 F: CGGCGACACAGGACAATCTT R: CCTGTATCCTGTCTTCCGGC CRX N/A F: CCTTCTGACAGCTCGGTGTT R: TGGTGTACTTCAGCGGTCAC FOXN4 Mm00521694_m1 F: CGTACAGCTGTCTGATCGCC R: GGAGCCGCTCATCTTGTTCT HB9 Mm01222622_m1 F: TCTCTTAACGGGAAGGGGCA R: CTAATTCAGGGCGCTCTCGG LHX3 Mm01330619_g1 N/A N/A SOX14 N/A F: GAACCCTTGCACTCCCTACC R: TCGATGTATGGCCGCTTCTC Open in a separate window Primers used in qPCR for mouse and human analyses. list-behavior=simple prefix-word= mark-type=none max-label-size=2 D. Calcium analysis of mouse cells – TIMING: variable list-behavior=enumerated prefix-word= mark-type=lower-roman max-label-size=0 For calcium imaging, seed co-cultured aggregates onto laminin-coated wells in DFK5NB medium supplemented with B27, 100x GlutaMAX , 5 ng/mL of NT-3, GDNF, BDNF, PDGF, and 0.5 μL/mL of reconstituted AAV1-hSyn-GCaMP6f vector.

Techniques: Flow Cytometry, Standard Deviation